si:ch211-160j14.2

Ensembl ID:
ENSDARG00000073961
ZFIN ID:
ZDB-GENE-091118-113
Human Orthologue:
C5orf32
Human Description:
chromosome 5 open reading frame 32 [Source:HGNC Symbol;Acc:30239]
Mouse Orthologue:
0610010O12Rik
Mouse Description:
RIKEN cDNA 0610010O12 gene Gene [Source:MGI Symbol;Acc:MGI:1913310]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23983 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23983
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114964 Nonsense 98 107 2 2
ENSDART00000131651 Nonsense 98 107 3 3
Genomic Location (Zv9):
Chromosome 21 (position 30819675)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32019145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCATTCTGGAGAGAAGGCTTGTCTAGCCACATGTTGGACGGCTCTGTG[T/A]TTCTGTTGTCTCTGTGACATGTGCTTTTAACCAAATTAACCAAAAGCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link