si:dkey-117i6.1

Ensembl ID:
ENSDARG00000073957
ZFIN ID:
ZDB-GENE-090312-209
Human Orthologue:
TOX3
Human Description:
TOX high mobility group box family member 3 [Source:HGNC Symbol;Acc:11972]
Mouse Orthologue:
Tox3
Mouse Description:
TOX high mobility group box family member 3 Gene [Source:MGI Symbol;Acc:MGI:3039593]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9897 Splice Site, Nonsense Available for shipment Available now
sa15483 Nonsense Available for shipment Available now
sa34124 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9897
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113342 Splice Site, Nonsense 311 587 5 7
ENSDART00000138631 Splice Site, Nonsense 164 440 2 4
Genomic Location (Zv9):
Chromosome 7 (position 38356516)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 36693156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCAAGATAGTAGCCTCCATGTGGGATGGACTGGGAGAAGAGCAGAAG[C/T]AGGTATTAAACTCACTRAAATYATTTTTCTAATCCTCACATGAACACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113342 Nonsense 438 587 7 7
ENSDART00000138631 Nonsense 291 440 4 4
Genomic Location (Zv9):
Chromosome 7 (position 38359288)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 36695928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGCAGTCGCAGCTGTTGGGGCAGATGGGTCCGCAGTCGAGCGTGWCGT[C/A]GCAATTGAGYCCGCCAATGCARCCCCGACATTCATCCATGCAGCAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113342 Nonsense 458 587 7 7
ENSDART00000138631 Nonsense 311 440 4 4
Genomic Location (Zv9):
Chromosome 7 (position 38359347)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 36695987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCGCCAATGCAACCCCGACATTCATCCATGCAGCAGCAGATGCAGCAG[C/T]AGCATCAGATGCAGCAGCATTTGCAGCACCACCAAATGCAGCAACAGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: A combined analysis of genome-wide association studies in breast cancer. (View Study)
  • Breast cancer: A multistage genome-wide association study in breast cancer identifies two new risk alleles at 1p11.2 and 14q24.1 (RAD51L1). (View Study)
  • Breast cancer: Genome-wide association study identifies five new breast cancer susceptibility loci. (View Study)
  • Breast cancer: Identification of a functional genetic variant at 16q12.1 for breast cancer risk: results from the Asia Breast Cancer Consortium. (View Study)
  • Breast cancer: Novel breast cancer susceptibility locus at 9q31.2: results of a genome-wide association study. (View Study)
  • Breast cancer (male) : Genome-wide association study identifies a common variant in RAD51B associated with male breast cancer risk. (View Study)
  • Polycystic ovary syndrome: Genome-wide association study identifies eight new risk loci for polycystic ovary syndrome. (View Study)
  • Restless legs syndrome: Genome-wide association study identifies novel restless legs syndrome susceptibility loci on 2p14 and 16q12.1. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link