si:ch73-386h18.1

Ensembl ID:
ENSDARG00000073944
ZFIN IDs:
ZDB-GENE-050309-237, ZDB-GENE-050506-128
Human Orthologues:
ZFHX3, ZFHX4
Human Descriptions:
zinc finger homeobox 3 [Source:HGNC Symbol;Acc:777]
zinc finger homeobox 4 [Source:HGNC Symbol;Acc:30939]
Mouse Orthologues:
Zfhx3, Zfhx4
Mouse Descriptions:
zinc finger homeobox 3 Gene [Source:MGI Symbol;Acc:MGI:99948]
zinc finger homeodomain 4 Gene [Source:MGI Symbol;Acc:MGI:2137668]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43032 Nonsense Mutation detected in F1 DNA During 2017
sa6496 Nonsense Mutation detected in F1 DNA During 2017
sa28966 Nonsense Mutation detected in F1 DNA During 2017
sa36560 Nonsense Mutation detected in F1 DNA During 2017
sa43031 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113668 Nonsense 117 2962 1 10
ENSDART00000138972   None 2329 None 5
ENSDART00000148008 Nonsense 266 980 1 2
Genomic Location (Zv9):
Chromosome 18 (position 5196388)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5915284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCCAGGCAACCTCCCACTCCTCTGTTTCCTAAAACCAAAAAGGAATTG[T/A]GAGTCTGTGGTACCACTTAACCTGGCATCTTCAAACTCTGTGAACAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113668 Nonsense 560 2962 1 10
ENSDART00000138972   None 2329 None 5
ENSDART00000148008 Nonsense 709 980 1 2
Genomic Location (Zv9):
Chromosome 18 (position 5195061)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5916611
KASP Assay ID:
554-4678.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGGCGGTGTGAAGTCTGCGACTATGAAACYAATGTGGCACGCAACCTC[C/T]GAATCCACATGACCAGTGAAAAGCACACACACAACGTGCTTCTACTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113668 Nonsense 2158 2962 9 10
ENSDART00000138972 Nonsense 1296 2329 4 5
ENSDART00000148008   None 980 None 2
Genomic Location (Zv9):
Chromosome 18 (position 5174988)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5936684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCTCACAAAAGATTTTTAGCCCTTTAGAGACTCCTGTATCTGAGCAA[C/T]AACAACAACAGAAACTATCCCAGGATATGAGCCCTTACAACTGCATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113668 Nonsense 2494 2962 9 10
ENSDART00000138972 Nonsense 1632 2329 4 5
ENSDART00000148008   None 980 None 2
Genomic Location (Zv9):
Chromosome 18 (position 5173980)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5937692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAAACGATGAAGGAAATGACTCTCTAGAAGCTCAACATGGCAGTATT[G/T]AGCACATGTCTCCCAGCACCGAAAGGGAGGCTTCTTCTGAAAGTGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113668 Nonsense 2603 2962 9 10
ENSDART00000138972 Nonsense 1741 2329 4 5
ENSDART00000148008   None 980 None 2
Genomic Location (Zv9):
Chromosome 18 (position 5173653)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5938019
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTATAAAACCCCAACAATGCTTGAGTGTGAAGCCTTGGGCAATGACATC[G/T]GACTTGCCAAAAGGGTGGTTCAGGTGTGGTTTCAGAATGCTCGTGCCAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Atrial fibrillation: A sequence variant in ZFHX3 on 16q22 associates with atrial fibrillation and ischemic stroke. (View Study)
  • Atrial fibrillation: Meta-analysis identifies six new susceptibility loci for atrial fibrillation. (View Study)
  • Atrial fibrillation: Variants in ZFHX3 are associated with atrial fibrillation in individuals of European ancestry. (View Study)
  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Kawasaki disease: A genome-wide association study identifies novel and functionally related susceptibility Loci for Kawasaki disease. (View Study)
  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)
  • Stroke (ischemic): Genetic risk factors for ischaemic stroke and its subtypes (the METASTROKE collaboration): a meta-analysis of genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link