ENSDARG00000073938

Ensembl ID:
ENSDARG00000073938

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19386 Nonsense Mutation detected in F1 DNA During 2015
sa24803 Essential Splice Site Mutation detected in F1 DNA During 2015
sa30480 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa19386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057346 Nonsense 338 963 5 20
Genomic Location:
Chromosome Zv9_NA774 (position 2961)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTTTGTGCAAGGCATATGGCGACCCTCATTATCGATCTTTTGATGGA[C/T]AATATTATACTTTTCATGGAAACTGCACTTATGTGTTGATGGAAGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24803
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057346 Essential Splice Site 784 963 16 20
Genomic Location:
Chromosome Zv9_NA774 (position 19747)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGAATCCTTAGAGTTTTTATAACTATAAACTTGTTTTTATCCTTCAA[G/A]TTCTTTGAATACGTGAAACAAGAGGGAGACTGCTGTGGAACATGTAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057346 Nonsense 880 963 19 20
Genomic Location:
Chromosome Zv9_NA774 (position 22035)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACACAAGCTTACCTTTCTCCATTCATCCACAGGTGAAACTCGCAACTG[T/A]GTCCGTCAGAGAAATATCACCCGTCTGCAAGTGGATGACTGCACTTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dlqz1aoz