fam59b

Ensembl ID:
ENSDARG00000073933
ZFIN ID:
ZDB-GENE-081031-49
Human Orthologue:
FAM59B
Human Description:
family with sequence similarity 59, member B [Source:HGNC Symbol;Acc:27172]
Mouse Orthologue:
Fam59b
Mouse Description:
family with sequence similarity 59, member B Gene [Source:MGI Symbol;Acc:MGI:2685290]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29462 Nonsense Mutation detected in F1 DNA During 2017
sa32317 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108493 Nonsense 167 810 4 6
Genomic Location (Zv9):
Chromosome 20 (position 48680983)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48581075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGACTCTTATGGGCCAAGCAGAACTGCTCTGCGTCCAATCAACTCGC[G/T]AGAAATCCCGCCTCACGGCGCTACTGCGCCGCCTGGGCAAAGCAGGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108493 Nonsense 417 810 4 6
Genomic Location (Zv9):
Chromosome 20 (position 48680233)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48580325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCGTCGACTCGCACACGCTGCCCTCTAGTGACGGCGATGGGGAAGAG[C/T]GAGAGTACGTCACGCCTGATTGGTCGACAGAGTCGCAGGAGATTCCATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link