mrc1a

Ensembl ID:
ENSDARG00000073928
ZFIN ID:
ZDB-GENE-090915-4
Description:
Mannose receptor C1-like protein [Source:UniProtKB/TrEMBL;Acc:C1J0C7]
Human Orthologues:
MRC1, MRC1L1
Human Descriptions:
mannose receptor, C type 1 [Source:HGNC Symbol;Acc:7228]
mannose receptor, C type 1-like 1 [Source:HGNC Symbol;Acc:23403]
Mouse Orthologue:
Mrc1
Mouse Description:
mannose receptor, C type 1 Gene [Source:MGI Symbol;Acc:MGI:97142]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3626 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2407 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21118 Nonsense Available for shipment Available now
sa21117 Nonsense Mutation detected in F1 DNA During 2014
sa8294 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18898 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Essential Splice Site 353 1440 6 30
Genomic Location:
Chromosome 7 (position 65451753)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTACATCTGTCGCAAAGGCAATTCAACAGATAACACACCTCCACCAG[G/A]TAAAATTTTATCTGTGCAGTAAATGCATTGAATTATCTGGGTAAATATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Essential Splice Site 354 1440 7 30
Genomic Location:
Chromosome 7 (position 65448818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTATTAAAACATGACATGGCAAGGTTTTACAAAGATATTTTTCTTGC[A/C]GGTAAAGATCAGCCCAACTTCTGTCCTGCTGCATGGGTGCCATATGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Nonsense 374 1440 7 30
Genomic Location:
Chromosome 7 (position 65448755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAACTTCTGTCCTGCTGCATGGGTGCCATATGCTGGTAATTGCTATTA[T/A]CTGCAGCGCACCAAGAAAATGTGGAATGATGCATTAGCAGCATGTCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Nonsense 820 1440 17 30
Genomic Location:
Chromosome 7 (position 65431421)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTTCATCAACGAAGAGTCCCTACCTATGGAAGATGCTCGCTCGTTCTG[C/A]AAAAAGAATAATGGGGATCTTGTTGTCATTACTGGACAAACAGAGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Essential Splice Site 1296 1440 27 30
ENSDART00000112544 Essential Splice Site 1296 1440 27 30
Genomic Location:
Chromosome 7 (position 65411428)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGACGGAGTYAGATCATTCTGGATTGGCATGCATCGCAGTTATATGG[G/A]TTAGAAACACACNNAAACCAAACAACCACAAGAATCAAAATKATATCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Essential Splice Site 1296 1440 27 30
ENSDART00000112544 Essential Splice Site 1296 1440 27 30
Genomic Location:
Chromosome 7 (position 65411428)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGACGGAGTCAGATCATTCTGGATTGGCATGCATCGCAGTTATATGG[G/A]TTAGAAACACACTTAAACCAAACAACCACAAGAATCAAAATTATATCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/71038mql