si:dkey-155f10.1

Ensembl ID:
ENSDARG00000073920
ZFIN ID:
ZDB-GENE-081105-126
Description:
Novel protein similar to vertebrate contactin associated protein family [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
CNTNAP5
Human Description:
contactin associated protein-like 5 [Source:HGNC Symbol;Acc:18748]
Mouse Orthologues:
Cntnap5a, Cntnap5b, Cntnap5c
Mouse Descriptions:
contactin associated protein-like 5A Gene [Source:MGI Symbol;Acc:MGI:3643623]
contactin associated protein-like 5B Gene [Source:MGI Symbol;Acc:MGI:3664583]
contactin associated protein-like 5C Gene [Source:MGI Symbol;Acc:MGI:3646013]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21481 Nonsense Available for shipment Available now
sa34635 Nonsense Mutation detected in F1 DNA During 2017
sa21482 Essential Splice Site Available for shipment Available now
sa31711 Essential Splice Site Available for shipment Available now
sa27395 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21483 Essential Splice Site Available for shipment Available now
sa41413 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112295 Nonsense 242 1306 5 24
ENSDART00000137759 Nonsense 215 1279 4 23

The following transcripts of ENSDARG00000073920 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24589344)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23745130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCGAGGAGATTATATCACTCTGGAGCTTCATCGTGGCAGGCTGGCCT[T/A]GCATCTAAACCTGGGTGAGTTACAGTACTTGGAGAAACCAGCAACTTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112295 Nonsense 349 1306 7 24
ENSDART00000137759 Nonsense 322 1279 6 23

The following transcripts of ENSDARG00000073920 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24602453)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23758239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGAACCTGTACTACAATGGAGTAAACATCATTGACCTGGCCAAACGA[C/T]GAAAGCCTCAGATCTACAGTGTGGTAAGCACTTGCTTTTGACAGTTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21482
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112295 Essential Splice Site 356 1306 7 24
ENSDART00000137759 Essential Splice Site 329 1279 6 23

The following transcripts of ENSDARG00000073920 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24602478)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23758264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACATCATTGACCTGGCCAAACGACGAAAGCCTCAGATCTACAGTGTGG[T/C]AAGCACTTGCTTTTGACAGTTTGGTTAAGACTTAGTGATGCTGCAGTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31711
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112295 Essential Splice Site 357 1306 8 24
ENSDART00000137759 Essential Splice Site 330 1279 7 23

The following transcripts of ENSDARG00000073920 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24608961)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23764747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCCCTGCATGCATGTAAACTGATGCTTTGACATTCTCTCTTCTCTCAC[A/T]GGGCAACGTGACCTTTTCCTGCTCCGAACCACAGCTGGTGGCCACCACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112295 Essential Splice Site 496 1306 9 24
ENSDART00000137759 Essential Splice Site 469 1279 8 23
ENSDART00000112295 Essential Splice Site 496 1306 9 24
ENSDART00000137759 Essential Splice Site 469 1279 8 23

The following transcripts of ENSDARG00000073920 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24612819)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23768605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCACCTGAAGAACTATCTGGAAGCCAAAGACAAACAATATTTTGGAGG[T/A]AAGATAATGCATAAATCTTGTTGATGAATGGCTAAGGGCATACACTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112295 Essential Splice Site 496 1306 9 24
ENSDART00000137759 Essential Splice Site 469 1279 8 23
ENSDART00000112295 Essential Splice Site 496 1306 9 24
ENSDART00000137759 Essential Splice Site 469 1279 8 23

The following transcripts of ENSDARG00000073920 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24612819)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23768605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCACCTGAAGAACTATCTGGAAGCCAAAGACAAACAATATTTTGGAGG[T/A]AAGATAATGCATAAATCTTGTTGATGAATGGCTAAGGGCATACACTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112295 Nonsense 1067 1306 19 24
ENSDART00000137759 Nonsense 1040 1279 18 23

The following transcripts of ENSDARG00000073920 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24640576)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23796362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCAGAGTCCTGCTATGCTCCTCACAGTCAACACTCTCAGCCAGCAGTA[T/A]GTGGCCGTCATCCTTGCTCGAAATGGTGAGATGGCTATGTCATATATCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link