si:ch211-202h22.7

Ensembl ID:
ENSDARG00000073912
ZFIN ID:
ZDB-GENE-090313-77
Description:
Novel protein similar to vertebrate lipopolysaccharide-induced TNF factor (LITAF) [Source:UniProtKB/

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32783 Essential Splice Site Mutation detected in F1 DNA During 2017
sa2000 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa32783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109919 Essential Splice Site 64 146 3 5
ENSDART00000141207 Essential Splice Site 64 146 5 7
Genomic Location (Zv9):
Chromosome 1 (position 55198101)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53981040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCAGTAATTCAGACGGTTCAGACTGCTGCGCCTCCTCCTGCCCAGAG[T/C]GAGTTATAAAGTCCTAGGCGATGTTTACACAACATTCATTTTCCTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2000
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109919 Nonsense 133 146 5 5
ENSDART00000141207 Nonsense 133 146 7 7
Genomic Location (Zv9):
Chromosome 1 (position 55199174)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53982113
KASP Assay ID:
554-3218.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGATTCCCTTCTGTGTGGATTCCTGCAAAGACGTCCAGCATCGCTG[T/A]CCAGGCTGCAAATCTCTTGTGTATGTGTACAAACGTAGTTAAGCTTGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link