FAM70A

Ensembl ID:
ENSDARG00000073911
Description:
family with sequence similarity 70, member A [Source:HGNC Symbol;Acc:26086]
Human Orthologue:
FAM70A
Human Description:
family with sequence similarity 70, member A [Source:HGNC Symbol;Acc:26086]
Mouse Orthologue:
Fam70a
Mouse Description:
family with sequence similarity 70, member A Gene [Source:MGI Symbol;Acc:MGI:3045722]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15149 Nonsense Available for shipment Available now
sa13146 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109615 Nonsense 62 343 2 11
Genomic Location:
Chromosome 14 (position 34428746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCTGGCGGCTACAACCAGGACGCAGAACATCACTGTTGGTGGCTATTA[T/A]CCAGGAGTCATTGTAAGTATGCTACCAATGTTGAYAGCCTCGCATATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109615 Nonsense 218 343 9 11
Genomic Location:
Chromosome 14 (position 34416989)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCATGAGTACACAGAGGTGCGGAGCTGCCAGGATGTTGTSCACCTYTA[T/A]CACCTGCTGTGGTCTGCTACWATCCTCAACATCGTRGCTTTGTTTCTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7wgjo55o