LOC559938

Ensembl ID:
ENSDARG00000073909
Human Orthologue:
PPIP5K1
Human Description:
diphosphoinositol pentakisphosphate kinase 1 [Source:HGNC Symbol;Acc:29023]
Mouse Orthologue:
Ppip5k1
Mouse Description:
diphosphoinositol pentakisphosphate kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2443281]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24657 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24658 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110730 Essential Splice Site 261 1157 6 28
Genomic Location:
Chromosome 25 (position 19750081)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTTACATCTACGAGGAGTTCATGCCCACAGATGGCACTGATGTCAAG[G/C]TACAAAAGTATTTCATTAGACACTATGTGGTGTTTGGATGGCTTGTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110730 Nonsense 595 1157 16 28
Genomic Location:
Chromosome 25 (position 19799986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTATATTTAACATTATTTTTTTTCTGCATGGCTGTGTTCAGGGTCTGT[T/A]AGCTCTAGAAGGAGAGTTGACCCCTATCCTGGTTCAGATGGTGAAGAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o850yh8v