LOC559938

Ensembl ID:
ENSDARG00000073909
Human Orthologue:
PPIP5K1
Human Description:
diphosphoinositol pentakisphosphate kinase 1 [Source:HGNC Symbol;Acc:29023]
Mouse Orthologue:
Ppip5k1
Mouse Description:
diphosphoinositol pentakisphosphate kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2443281]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30242 Nonsense Mutation detected in F1 DNA During 2016
sa24657 Essential Splice Site Available for shipment Available now
sa24658 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110730 Nonsense 235 1157 6 28
Genomic Location (Zv9):
Chromosome 25 (position 19750002)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19161979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGCTCAAACACTCTGTCCTGTAGATTGGCAGCCGGAGCAGTGTTTA[T/A]TCTCCTGAAAGTACTGTCCGTAAGACTGGGTCTTACATCTACGAGGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110730 Essential Splice Site 261 1157 6 28
Genomic Location (Zv9):
Chromosome 25 (position 19750081)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19162058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTTACATCTACGAGGAGTTCATGCCCACAGATGGCACTGATGTCAAG[G/C]TACAAAAGTATTTCATTAGACACTATGTGGTGTTTGGATGGCTTGTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110730 Nonsense 595 1157 16 28
Genomic Location (Zv9):
Chromosome 25 (position 19799986)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19211963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTATATTTAACATTATTTTTTTTCTGCATGGCTGTGTTCAGGGTCTGT[T/A]AGCTCTAGAAGGAGAGTTGACCCCTATCCTGGTTCAGATGGTGAAGAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link