ptpn9b

Ensembl ID:
ENSDARG00000073902
ZFIN ID:
ZDB-GENE-090313-52
Description:
Novel protein similar to vertebrate protein tyrosine phosphatase, non-receptor type 9 (PTPN9) [Sourc
Human Orthologue:
PTPN9
Human Description:
protein tyrosine phosphatase, non-receptor type 9 [Source:HGNC Symbol;Acc:9661]
Mouse Orthologue:
Ptpn9
Mouse Description:
protein tyrosine phosphatase, non-receptor type 9 Gene [Source:MGI Symbol;Acc:MGI:1928376]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39590 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19465 Nonsense Available for shipment Available now
sa11894 Nonsense Available for shipment Available now
sa19466 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39590
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114514 Essential Splice Site 88 754 3 13
Genomic Location (Zv9):
Chromosome 1 (position 17840557)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18405725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGAGCCTTTAAGGAGCGAGTTACTCAGTGGGAAATTCACAGTTCTGG[T/C]GAGTACGGTTTCACATCTACATAATGTGTGAATGTGTGAACTACTCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114514 Nonsense 129 754 4 13
Genomic Location (Zv9):
Chromosome 1 (position 17843291)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18408459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCATAAAGCTGTTCTTCAGGCCATTATATATCAGCTGGATAAGGCTATT[G/T]AGAGGTAAAAAAAAAAAAAAAAGACCACGTCCATTAAACTGATGAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11894
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114514 Nonsense 258 754 7 13
Genomic Location (Zv9):
Chromosome 1 (position 17847148)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18412316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCAGCCCCAATCACCCCAATAACTCTGCATACGTCACTGGGGATTGCT[T/A]GGGGAGTCTGCTCTGCTCCTACTCCATGGAGCACGACCAGAACACCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114514 Nonsense 380 754 7 13
Genomic Location (Zv9):
Chromosome 1 (position 17847513)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18412681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTAGGAGGAGCGTGTTTAGATGCCAGTCGGCAGGATGGCAATGGTGCT[G/T]AGGAGAGTCAACAGGATGTGGAGTTACTAGAAGACGAAATGGGTGAAGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link