C1orf183

Ensembl ID:
ENSDARG00000073900
Description:
chromosome 1 open reading frame 183 [Source:HGNC Symbol;Acc:28045]
Human Orthologue:
C1orf183
Human Description:
chromosome 1 open reading frame 183 [Source:HGNC Symbol;Acc:28045]
Mouse Orthologue:
6530418L21Rik
Mouse Description:
RIKEN cDNA 6530418L21 gene Gene [Source:MGI Symbol;Acc:MGI:1923497]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8411 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110857 Nonsense 175 330 2 2
Genomic Location:
Chromosome 8 (position 29118644)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCCATTGACGACCCCAGCGATTGGACTRCTTCACTGATGAACCACAGC[A/T]GAAACAGACAGCCATTAGTGTTGGGTGACAACGTGTTCGCAGATTTGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6ka9qg2q