cx47.1

Ensembl ID:
ENSDARG00000073896
ZFIN ID:
ZDB-GENE-040912-134
Description:
connexin 47.1 [Source:RefSeq peptide;Acc:NP_001004574]
Human Orthologue:
GJC2
Human Description:
gap junction protein, gamma 2, 47kDa [Source:HGNC Symbol;Acc:17494]
Mouse Orthologue:
Gjc2
Mouse Description:
gap junction protein, gamma 2 Gene [Source:MGI Symbol;Acc:MGI:2153060]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25746 Nonsense Mutation detected in F1 DNA During 2015
sa11554 Nonsense Available for shipment Available now
sa540 Nonsense F2 line generated During 2015

Mutation Details

Allele Name:
sa25746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115278 Nonsense 123 409 2 2
Genomic Location:
Chromosome 2 (position 3991208)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGACACAAGAACCAGATTTACCAGAAGAGGAGGCACCACAGTCGCTGG[A/T]GAAACGGACACCATCTAGAGGACGCTTTAGAGGAGGAAGATGAGGACGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115278 Nonsense 177 409 2 2
Genomic Location:
Chromosome 2 (position 3991372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACACGATGGCCGCCGCAGGATCATGCAAGAAGGTTTAATGAGGATGTA[T/A]GTWCTTCAACTTTTATCYCGCGCCATCTTYGAGGTGGGATTCCTCAYGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa540
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115278 Nonsense 310 409 2 2
Genomic Location:
Chromosome 2 (position 3991769)
KASP Assay ID:
554-0450.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAATCCGACAAACCCGGTCGCATTCCCAACAGCATCGTCCTGCCTGAT[C/T]AGAACATGGATAGAGAGATCGCAGAACAACACTGCACAAGTCCTGATGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6lxvh2ur