cx47.1

Ensembl ID:
ENSDARG00000073896
ZFIN ID:
ZDB-GENE-040912-134
Description:
connexin 47.1 [Source:RefSeq peptide;Acc:NP_001004574]
Human Orthologue:
GJC2
Human Description:
gap junction protein, gamma 2, 47kDa [Source:HGNC Symbol;Acc:17494]
Mouse Orthologue:
Gjc2
Mouse Description:
gap junction protein, gamma 2 Gene [Source:MGI Symbol;Acc:MGI:2153060]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11554 Nonsense Available for shipment Available now
sa540 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa11554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115278 Nonsense 177 409 2 2
Genomic Location:
Chromosome 2 (position 3991372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACACGATGGCCGCCGCAGGATCATGCAAGAAGGTTTAATGAGGATGTA[T/A]GTWCTTCAACTTTTATCYCGCGCCATCTTYGAGGTGGGATTCCTCAYGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa540
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115278 Nonsense 310 409 2 2
Genomic Location:
Chromosome 2 (position 3991769)
KASP Assay ID:
554-0450.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAATCCGACAAACCCGGTCGCATTCCCAACAGCATCGTCCTGCCTGAT[C/T]AGAACATGGATAGAGAGATCGCAGAACAACACTGCACAAGTCCTGATGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6lxvh2ur