si:ch211-261c8.1

Ensembl ID:
ENSDARG00000073892
ZFIN ID:
ZDB-GENE-050208-263
Description:
Si:ch211-261c8.1 protein [Source:UniProtKB/TrEMBL;Acc:Q3B737]
Human Orthologue:
SECISBP2
Human Description:
SECIS binding protein 2 [Source:HGNC Symbol;Acc:30972]
Mouse Orthologue:
Secisbp2
Mouse Description:
SECIS binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1922670]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33758 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073905   None 169 None 4
ENSDART00000114005 Nonsense 65 349 2 8
ENSDART00000132789 Nonsense 220 546 6 12
Genomic Location (Zv9):
Chromosome 5 (position 69248991)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65581926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCGCACAACCCGCTGGACTCCACCTGTCCTTCAGTGAAGAAAGGAAAA[C/T]AGAGAGAAGTCCCTAAAGCCAAAAAACCAACACCACTCAAACGAGTAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link