NP_001165060.1

Ensembl ID:
ENSDARG00000073891
Description:
bone morphogenetic protein 3b [Source:RefSeq peptide;Acc:NP_001165060]
Human Orthologue:
GDF10
Human Description:
growth differentiation factor 10 [Source:HGNC Symbol;Acc:4215]
Mouse Orthologue:
Gdf10
Mouse Description:
growth differentiation factor 10 Gene [Source:MGI Symbol;Acc:MGI:95684]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38866 Nonsense Mutation detected in F1 DNA During 2017
sa10224 Nonsense Available for shipment Available now
sa35177 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114209 Nonsense 108 422 2 3
Genomic Location (Zv9):
Chromosome 12 (position 3217229)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2604229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACCTCCGTTCCCGATTCGGAGATGATACTGACGTCAAATCTGCATTA[T/A]CCTGACCAACAATCTCGCCCTCGTTCTTGGGCCTGCCAGCGTTCCCGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114209 Nonsense 168 422 2 3
Genomic Location (Zv9):
Chromosome 12 (position 3217408)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2604408
KASP Assay ID:
2260-4796.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAACTCAACTCAGCAACATCACATTAYCGCCAAACAGAAAAACMCTTT[G/A]GCAGACTGCRGATGTRTCCTCAGCTATGAAGCAAGCTCATRCGAACGCYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114209 Nonsense 283 422 2 3
Genomic Location (Zv9):
Chromosome 12 (position 3217752)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2604752
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTGATCTTAAGAGCGGGGGGTTATGGGATGGAGCGTTTTTTGCGAAA[C/T]AAAACAAACCCTTGACTGACATTGAAGGCTCGAGGGGGTCTCAGGAGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link