si:dkey-197a20.4

Ensembl ID:
ENSDARG00000073883
ZFIN ID:
ZDB-GENE-100921-73
Human Orthologue:
CLSTN3
Human Description:
calsyntenin 3 [Source:HGNC Symbol;Acc:18371]
Mouse Orthologue:
Clstn3
Mouse Description:
calsyntenin 3 Gene [Source:MGI Symbol;Acc:MGI:2178323]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32075 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110567 Nonsense 760 969 16 20
ENSDART00000142574   None 280 None 6
Genomic Location (Zv9):
Chromosome 16 (position 13867520)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12226611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGTCTTTGAGAGAGAGGGGGCTCGACATCATCAACACAACGGCCTA[C/A]ATTGCCATTACTGGTAATTTTGACTAATTATTACTAAGTTTGCCAGCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link