LOC566242

Ensembl ID:
ENSDARG00000073881
Human Orthologue:
SLC41A2
Human Description:
solute carrier family 41, member 2 [Source:HGNC Symbol;Acc:31045]
Mouse Orthologue:
Slc41a2
Mouse Description:
solute carrier family 41, member 2 Gene [Source:MGI Symbol;Acc:MGI:2442940]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33387 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20207 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33387
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113867 Essential Splice Site 325 555 5 10
Genomic Location (Zv9):
Chromosome 4 (position 8135972)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9064322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCTGGCCATCCTAGCATGGATCAGCCAGGGCCTATACAACTGCATAGG[T/C]GAGTACAATATGTTAGAAAGTAAGGACTCCAAAACCTAGTGAGCTGCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113867 Essential Splice Site 445 555 8 10
Genomic Location (Zv9):
Chromosome 4 (position 8152082)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9080432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAGGCCAAGGGTTGCTACTATCCCTGCCGCACCTTCTGTGGCTCAGG[T/C]AACCTTCAGCACTGCTCCATACATGTGGTGAATATAGCCACGTTTGAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link