tpst1

Ensembl ID:
ENSDARG00000073872
ZFIN ID:
ZDB-GENE-000210-10
Description:
Protein-tyrosine sulfotransferase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q9PTE6]
Human Orthologue:
TPST1
Human Description:
tyrosylprotein sulfotransferase 1 [Source:HGNC Symbol;Acc:12020]
Mouse Orthologue:
Tpst1
Mouse Description:
protein-tyrosine sulfotransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1298231]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22625 Nonsense Available for shipment Available now
sa9716 Nonsense Available for shipment Available now
sa18619 Nonsense Available for shipment Available now
sa19108 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114464 Nonsense 23 355 2 5
ENSDART00000128534 Nonsense 23 366 1 4
ENSDART00000136767 None None 28 None 3
ENSDART00000143610 None None 11 None 2
Genomic Location:
Chromosome 15 (position 19671405)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAACTTACTAGTGGCCTGTCTGGTCATTAGCTCGGTCACAGTCTTCTA[T/A]CTGTGTCGCCATGCCATGGACTGCCATCACCGGATAGAGGAGCGCAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114464 Nonsense 40 355 2 5
ENSDART00000128534 Nonsense 40 366 1 4
ENSDART00000136767 None None 28 None 3
ENSDART00000143610 None None 11 None 2
Genomic Location:
Chromosome 15 (position 19671356)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGTGTCGCCATGCCATGGACTGCCATCACCGGATAGAGGAGCGCAGC[C/T]AGCCCCTGTTGAGCAGCTTGCACGCCACCCTCCGAACAGGCCAAAACCTY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114464 Nonsense 166 355 2 5
ENSDART00000128534 Nonsense 166 366 1 4
ENSDART00000136767 None None 28 None 3
ENSDART00000143610 None None 11 None 2
Genomic Location:
Chromosome 15 (position 19670976)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAACTACCTGTGTAATAAAGACCCGTTTGCTCTTAAATCACTSACTTA[T/A]CTGGCCAAGATCTWCCCGCATGCTAAGTTCATTCTTATGRTKCGTGACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114464 Essential Splice Site None 355 4 5
ENSDART00000128534 None None 366 None 4
ENSDART00000136767 Essential Splice Site None 28 2 3
ENSDART00000143610 Essential Splice Site None 11 1 2
Genomic Location:
Chromosome 15 (position 19617513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCCAAACCCAAGTTAAGAGAAGAGGACGAGTGCTTTATCAGTAGAAG[T/G]GAGTTTTTATCATATTTGCTAGAAGACTTTGCTTCCCTTTTTTCTACCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rfegxe3i