pdzrn3

Ensembl ID:
ENSDARG00000073869
ZFIN ID:
ZDB-GENE-071022-4
Human Orthologue:
PDZRN3
Human Description:
PDZ domain containing ring finger 3 [Source:HGNC Symbol;Acc:17704]
Mouse Orthologue:
Pdzrn3
Mouse Description:
PDZ domain containing RING finger 3 Gene [Source:MGI Symbol;Acc:MGI:1933157]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20799 Nonsense Available for shipment Available now
sa40775 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20799
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114330 Nonsense 25 1053 1 10
Genomic Location (Zv9):
Chromosome 6 (position 44333209)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 44404373
KASP Assay ID:
2259-8030.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGGGGCTGTGGACCCAGACTTCAAATGCAACTTGTGTAATAAAGTTT[T/A]GGAGGATCCGCTCACTACCCCGTGCGGTCATGTCTTCTGCGCCGGCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40775
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114330 Nonsense 611 1053 10 10
Genomic Location (Zv9):
Chromosome 6 (position 44178003)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 44249167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCAGCGCCTCCACCACACTGGGCAGCCGGCGCAGACTCGCATACAGT[C/T]AGGACACCCTTGGCAGTGGTGACCTCCCCTTCAGCAGCGAGTCCTTCATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link