tdp1

Ensembl ID:
ENSDARG00000073866
ZFIN ID:
ZDB-GENE-090909-1
Human Orthologue:
TDP1
Human Description:
tyrosyl-DNA phosphodiesterase 1 [Source:HGNC Symbol;Acc:18884]
Mouse Orthologue:
Tdp1
Mouse Description:
tyrosyl-DNA phosphodiesterase 1 Gene [Source:MGI Symbol;Acc:MGI:1920036]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4006 Nonsense Mutation detected in F1 DNA During 2014
sa23033 Nonsense Mutation detected in F1 DNA During 2014
sa6467 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108712 Nonsense 154 615 1 15
Genomic Location:
Chromosome 17 (position 16262051)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTGAAGACAAGCGTCCTCCAAGCCCTCACGGCACTAGTTATTATAAA[G/T]AAGAGCCAGCTGATTTCTTTGAGACCAACTTAATGCCTACAAATGACATK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108712 Nonsense 392 615 9 15
Genomic Location:
Chromosome 17 (position 16243934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCATGAACTCATTGTTTTTGTTTCCCTCAGTTGCTCAGCGAGCATACG[C/T]AACCCATGCAGAACGAAGAGCGATGGCACGTGCTTGGCCAGTTCTCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108712 Nonsense 478 615 11 15
Genomic Location:
Chromosome 17 (position 16240941)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCTTYAGCTGGAGGATCTTTACCTTACAGYATACAGACGGCACAAAAA[C/T]AGCTCTGGCTTCATTCTTACTTCCAGTAAGTTCTTYTTTCTCTTTCTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5zor8nqb