ptpn13

Ensembl ID:
ENSDARG00000073862
ZFIN ID:
ZDB-GENE-070410-72
Description:
LOC569591 protein [Source:UniProtKB/TrEMBL;Acc:A4QN87]
Human Orthologue:
PTPN13
Human Description:
protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase) [Source
Mouse Orthologue:
Ptpn13
Mouse Description:
protein tyrosine phosphatase, non-receptor type 13 Gene [Source:MGI Symbol;Acc:MGI:103293]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37238 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37239 Nonsense Mutation detected in F1 DNA During 2017
sa43585 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37240 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017
sa16302 Essential Splice Site Available for shipment Available now
sa25149 Nonsense Mutation detected in F1 DNA During 2017
sa43586 Nonsense Mutation detected in F1 DNA During 2017
sa43587 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37241 Nonsense Available for shipment Available now
sa23860 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098081   None 299 None 6
ENSDART00000109442   None 2525 None 70
ENSDART00000111101 Essential Splice Site None 1302 1 24
ENSDART00000141947   None 140 None 3
ENSDART00000144506 Essential Splice Site None 2475 1 49
Genomic Location (Zv9):
Chromosome 21 (position 8734923)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9469236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGGCTAGTTGGAGCGAAGTTTGAAGTTGTGGGACGCTTATTTTAGAG[G/A]TAAGTTTGTGTGTTTTACTTAAATATTTGGTTGATGCTGCTGCTGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098081   None 299 None 6
ENSDART00000109442 Nonsense 405 2525 12 70
ENSDART00000111101   None 1302 None 24
ENSDART00000141947   None 140 None 3
ENSDART00000144506   None 2475 None 49
Genomic Location (Zv9):
Chromosome 21 (position 8812835)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9391324
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTGAGTCAATGATTCAGAGTTTCCTACATGGGCTTAGGCTGGAAATG[C/T]AAACTGAGGAATAATTTGACTGAGAAGCAGCATAGACAGCAGCTATAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43585
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098081   None 299 None 6
ENSDART00000109442 Essential Splice Site 767 2525 22 70
ENSDART00000111101 Essential Splice Site 751 1302 15 24
ENSDART00000141947   None 140 None 3
ENSDART00000144506 Essential Splice Site 751 2475 15 49
Genomic Location (Zv9):
Chromosome 21 (position 8825639)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9378520
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATACTACAACGCTTCAGAGCAGGAGGCCGAGCTGGAGTTCCTCAAGG[T/G]CAGGACTTAAACCAAACACATCAGTCCCATCACTAAATTCCTGATTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098081   None 299 None 6
ENSDART00000109442 Essential Splice Site 1339 2525 None 70
ENSDART00000111101 Missense 1295 1302 24 24
ENSDART00000141947 Essential Splice Site 63 140 None 3
ENSDART00000144506 Essential Splice Site 1294 2475 None 49
Genomic Location (Zv9):
Chromosome 21 (position 8850335)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9353824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGAAGACACGTACTCGAATAGCCAAGACAAATTAAAGACTAAAAAGG[T/C]AGACTCACTCTCTGTAGTGATTTAAGTGAACTTTGACTCTCACCTCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16302
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098081   None 299 None 6
ENSDART00000109442   None 2525 None 70
ENSDART00000111101   None 1302 None 24
ENSDART00000141947 Essential Splice Site 111 140 2 3
ENSDART00000144506   None 2475 None 49
Genomic Location (Zv9):
Chromosome 21 (position 8854650)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9349509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAAATAGACAGCAGTCTGGGCATTAGTGYCACGGTACTGTTTGGAAAG[G/A]TTTCCGCTCTTTGTTTTTCTTCTTTATTCCTCTTTTACTTACNNTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098081   None 299 None 6
ENSDART00000109442 Nonsense 1648 2525 41 70
ENSDART00000111101   None 1302 None 24
ENSDART00000141947   None 140 None 3
ENSDART00000144506 Nonsense 1602 2475 31 49
Genomic Location (Zv9):
Chromosome 21 (position 8867059)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9337100
KASP Assay ID:
554-7717.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCTCTGGAGCGTCTGCTGCTCAAATCTCCCAGCCGCAGGGACAGTTA[C/A]AGCGATAGCACCGATAATGATGAACTCGAGGAAGCTTTCAGAGCTGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098081   None 299 None 6
ENSDART00000109442 Nonsense 2160 2525 60 70
ENSDART00000111101   None 1302 None 24
ENSDART00000141947   None 140 None 3
ENSDART00000144506 Nonsense 2102 2475 41 49
Genomic Location (Zv9):
Chromosome 21 (position 8899166)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9304992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGGAAGGGAACAGACACGAGTGCTGATCTGTCAGAGGACACAGACTG[T/A]GACGGTTCATCTCTGCCTGAAGACTCTCCAGAGGTACAAACATCTGCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098081   None 299 None 6
ENSDART00000109442   None 2525 None 70
ENSDART00000111101   None 1302 None 24
ENSDART00000141947   None 140 None 3
ENSDART00000144506 Essential Splice Site 2114 2475 42 49
Genomic Location (Zv9):
Chromosome 21 (position 8899301)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9304857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTACTGTACATGATGTGATCATATAGATGTGTTGTCCTCTTCTGTTTTC[A/T]GACGTCAAGAAAGGCTGAGTGGAAGGAAGAAAACGTTGATGCTCCACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098081 Nonsense 49 299 2 6
ENSDART00000109442 Nonsense 2275 2525 65 70
ENSDART00000111101   None 1302 None 24
ENSDART00000141947   None 140 None 3
ENSDART00000144506 Nonsense 2225 2475 45 49
Genomic Location (Zv9):
Chromosome 21 (position 8904791)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9299367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTATTTCCTCTCTAAGAACCTACAAAACCTGCGGCCCCTGGACGAATG[C/A]CTGATCGGCCAAACCAAAGAAAACAAGAAGAAAAACCGCTACAAGAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098081 Nonsense 272 299 5 6
ENSDART00000109442   None 2525 None 70
ENSDART00000111101   None 1302 None 24
ENSDART00000141947   None 140 None 3
ENSDART00000144506 Nonsense 2448 2475 48 49
Genomic Location (Zv9):
Chromosome 21 (position 8908896)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9295262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATATCAGATATTGTGCGCACCATGAGACTCCAGAGGCAGGGCATGGTA[C/T]AAACAGAGGTAATCAATCAATCATAATGCATGCATCGACATTAAACAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link