KIF13B (2 of 2)

Ensembl ID:
ENSDARG00000073859
Description:
kinesin family member 13B [Source:HGNC Symbol;Acc:14405]
Human Orthologue:
KIF13B
Human Description:
kinesin family member 13B [Source:HGNC Symbol;Acc:14405]
Mouse Orthologue:
Kif13b
Mouse Description:
kinesin family member 13B Gene [Source:MGI Symbol;Acc:MGI:1098265]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9347 Nonsense Mutation detected in F1 DNA During 2014
sa23817 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3078 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058858 Nonsense 623 1097 17 25
Genomic Location:
Chromosome 20 (position 50170983)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGATGCAGTCAGTGCTTCACTCTCTGGAGCGCAGACATGAGGAGGAGAAG[C/T]GATCTGCTCTGGAGCGTCAGCGGCTCATGTACGAGCAGGAGCTCCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058858 Essential Splice Site 933 1097 22 25
Genomic Location:
Chromosome 20 (position 50157405)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGCAGTAGAGAACCACAGAGTCTGGTGGTGTTCGACAACTGCAAGG[T/C]CTCAGTTCATCACAAAAAACACTACATTTGTGCCATTTATTTCTCTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058858 Nonsense 984 1097 23 25
Genomic Location:
Chromosome 20 (position 50154867)
KASP Assay ID:
554-3036.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGGCTCTCTGGGACCTGGGGGTGATTCAGGCCAAGACTCGCTCTCTC[A/T]GAGAAAGGTATATTTGCATTCTAGATTTTTATTGAATTTATATATATATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/42wolqrv