arhgef7b

Ensembl ID:
ENSDARG00000073848
ZFIN IDs:
ZDB-GENE-041212-49, ZDB-GENE-041212-49
Description:
Rho guanine nucleotide exchange factor (GEF) 7b [Source:RefSeq peptide;Acc:NP_001008624]
Human Orthologue:
ARHGEF7
Human Description:
Rho guanine nucleotide exchange factor (GEF) 7 [Source:HGNC Symbol;Acc:15607]
Mouse Orthologue:
Arhgef7
Mouse Description:
Rho guanine nucleotide exchange factor (GEF7) Gene [Source:MGI Symbol;Acc:MGI:1860493]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8932 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18335 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042086 Essential Splice Site None 643 None 21
ENSDART00000108528 Essential Splice Site 111 799 None 21
Genomic Location:
Chromosome 1 (position 46478094)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCACTTAAATGGTGAAGTAAATKWATRTTGATGTGTATTTTTTGATTGT[A/G]GAGTCCGGTGGAGGGAGTAACTCGGTGTGTTCCCGTCAATCGTCTTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042086 Nonsense 119 643 7 21
ENSDART00000108528 Nonsense 275 799 7 21
Genomic Location:
Chromosome 1 (position 46498097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACKGAGACTGAATATTGTAAAGAGCTCCAGAACCTCCTCTCCGTGTA[T/A]CYGAGAGCATTACARCCCACCGACAGGTAAGAAAACAAGCTCGCAATTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bf1fqtjn