MYO9A (2 of 2)

Ensembl ID:
ENSDARG00000073843
Description:
myosin IXA [Source:HGNC Symbol;Acc:7608]
Human Orthologue:
MYO9A
Human Description:
myosin IXA [Source:HGNC Symbol;Acc:7608]
Mouse Orthologue:
Myo9a
Mouse Description:
myosin IXa Gene [Source:MGI Symbol;Acc:MGI:107735]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39467 Nonsense Mutation detected in F1 DNA During 2016
sa44210 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16393 Nonsense Available for shipment Available now
sa37972 Nonsense Mutation detected in F1 DNA During 2016
sa24581 Nonsense Available for shipment Available now
sa30171 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Nonsense 59 1740 2 33
Genomic Location (Zv9):
Chromosome 25 (position 545467)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 504381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAATATTAAAAGTTGAAGAGGATTTAAGTCTGATGTCTTATGTGATCAG[G/T]AGGAGTATCGATCTGAGGGCATCAACTGGCACATGATCGATTATATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Essential Splice Site 325 1740 8 33
Genomic Location (Zv9):
Chromosome 25 (position 536510)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 495524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTGAAGGAGAAACAAGAACTACAAGCCCAAACCCAGCCTCCCTAAG[G/A]TAAACCTCACGACTTGAATGTGTGAAATACTCAGTGTTGGTTGTTTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Nonsense 465 1740 12 33
Genomic Location (Zv9):
Chromosome 25 (position 532925)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 491939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGGCATCCGAGAGTTCCTGCGCAGTGCAGACTTGGAGCCCAGYGGCTA[T/G]CAAGTGGGCCGCAGTATGGTAAGAGACACACTGACCAMCCCTATAATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Nonsense 705 1740 15 33
Genomic Location (Zv9):
Chromosome 25 (position 527889)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 486903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAACGAGAACTCGAACAAGCCACGTTCAGTTTAGAGCTGCTCAAAGTC[C/T]GATCCGGATCAAACACAGAAGACGCTCAGATCCCTCCGTCCAAACATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Nonsense 1302 1740 25 33
Genomic Location (Zv9):
Chromosome 25 (position 516842)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 475856
KASP Assay ID:
2261-9208.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGTGGAGAAGCTGATCAACTACATCGAGATGCACGGCCTCTACACC[G/T]AGGGCATCTACAGGAAGTCTGGATCCACCAATAAGATCAAAGAGCTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Nonsense 1453 1740 29 33
Genomic Location (Zv9):
Chromosome 25 (position 510323)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 469337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACTAAATGCCGTTATCTTGCCCTCAGGTGTGTGGAGCTTATCATCTG[T/A]GAGCAGATGAGGAAATATAAAGCCCGACTGAAGGACATCAACACACTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link