herc2

Ensembl ID:
ENSDARG00000073841
ZFIN ID:
ZDB-GENE-070718-6
Human Orthologue:
HERC2
Human Description:
hect domain and RLD 2 [Source:HGNC Symbol;Acc:4868]
Mouse Orthologue:
Herc2
Mouse Description:
hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 2

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15868 Nonsense Available for shipment Available now
sa13507 Nonsense Available for shipment Available now
sa13593 Nonsense Available for shipment Available now
sa13641 Nonsense Available for shipment Available now
sa20751 Essential Splice Site Available for shipment Available now
sa10421 Essential Splice Site Available for shipment Available now
sa20752 Nonsense Mutation detected in F1 DNA During 2014
sa20753 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110770 Nonsense 667 4832 14 93
Genomic Location:
Chromosome 6 (position 37727770)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGGTGTGCTGTGGGAGCCAGTTCTCCGTAGCGCTCACTAAAGATGGA[C/T]ARGTTTACACCTGGGGCAAAGGAGACAATCAACGACTTGGACATGGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110770 Nonsense 1088 4832 21 93
Genomic Location:
Chromosome 6 (position 37736814)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTCAGARATTCWGGGAGTTGGCTCTCTCYTGAAGAAGTATATGGCTT[T/A]GCKTTGCACACACATCGGTGATATCCTTCCTGTGGCCACCAGCATTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110770 Nonsense 1331 4832 26 93
ENSDART00000110770 Nonsense 1331 4832 26 93
Genomic Location:
Chromosome 6 (position 37740398)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGCATGTNAAAAAAAAAGTCACTTGCTYCTATACCTYCCAGAATGGCTC[C/T]AGTCATCYATTTTCTTYGGTGGACTTCAGACCAGTCAGATCCACTATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13641
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110770 Nonsense 1331 4832 26 93
ENSDART00000110770 Nonsense 1331 4832 26 93
Genomic Location:
Chromosome 6 (position 37740398)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGCATGTNAAAAAAAAAGTCACTTGCTYCTATACCTYCCAGAATGGCTC[C/T]AGTCATCYATTTTCTTYGGTGGACTTCAGACCAGTCAGATCCACTATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110770 Essential Splice Site 2535 4832 46 93
Genomic Location:
Chromosome 6 (position 37757566)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGAGGTGCTGGAAGAGCTTGAGGAGCCTGAGCCTGCCTTTCCTGTGG[T/A]ACATACAAATACACTGATCACACAATCCAGATGTGAGGTGCTGATTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110770 Essential Splice Site 2625 4832 48 93
Genomic Location:
Chromosome 6 (position 37758769)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAAGGAGGAACYTACTGGGTCCGTTACATCCACACTGAGCTGCTGGG[T/C]AATACTCTTTMTGTTCTCTTAMACATTTTTATAGGTATTTGTTAATTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110770 Nonsense 3466 4832 66 93
Genomic Location:
Chromosome 6 (position 37771813)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCAGAGAGTGAGGAGAGGGTCAGTCCGCACCCCTGGATGGACAGCAAA[C/T]GAGGAGAGGTGAGGAGTTCTGCCAATTCTTGACTGTGTGTGTGTATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110770 Nonsense 4262 4832 82 93
Genomic Location:
Chromosome 6 (position 37784148)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAAAAAGGTCATCGCAATAGCAACTGGTTCCCTTCACTGCGTTTGCTG[C/A]ACGGAGGACGGTAGGTCATTAGTATGTTTGAATTATGCTGGCCTTTGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Black vs. red hair color: A genome-wide association study identifies novel alleles associated with hair color and skin pigmentation. (View Study)
  • Eye color: Genome-wide association studies of quantitatively measured skin, hair, and eye pigmentation in four European populations. (View Study)
  • Eye color traits: Digital quantification of human eye color highlights genetic association of three new loci. (View Study)
  • Iris color: Three genome-wide association studies and a linkage analysis identify HERC2 as a human iris color gene. (View Study)
  • Vitiligo: Genome-wide association analyses identify 13 new susceptibility loci for generalized vitiligo. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/67e1i9r0