LOC100150735

Ensembl ID:
ENSDARG00000073836

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11815 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114698 Essential Splice Site 31 524 2 2
Genomic Location:
Chromosome 4 (position 58249129)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGCTCTCTAATTTGGTTTGCTTTATCTTYACTATACTATCTAATTTC[A/T]GGTGTTACTCTGTGGGACAGGAAATCAATGAATGACAATTTGGACACCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0j16iy86