LOC100334106

Ensembl ID:
ENSDARG00000073822
Human Orthologue:
IQSEC1
Human Description:
IQ motif and Sec7 domain 1 [Source:HGNC Symbol;Acc:29112]
Mouse Orthologue:
Iqsec1
Mouse Description:
IQ motif and Sec7 domain 1 Gene [Source:MGI Symbol;Acc:MGI:1196356]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37602 Nonsense Mutation detected in F1 DNA During 2016
sa43909 Nonsense Mutation detected in F1 DNA During 2016
sa37603 Nonsense Mutation detected in F1 DNA During 2016
sa25191 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092344 Nonsense 307 942 2 13
Genomic Location:
Chromosome 23 (position 4704517)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGCAGAATCTGATCAGCACACTCAGTCCGTCAGCGCCTCACAGGAGTA[T/G]TGGTCCATGGATGCTAACATGGACACAAGTGCCAGGAGCACTCCATCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092344 Nonsense 410 942 2 13
Genomic Location:
Chromosome 23 (position 4704824)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGAGACACCGGCAGGTGGTGAGTCATCTGGCCACCAATGGCAGCCGG[C/T]AGAGCAAGTCAGAATCTGACTTTTCCGATGGAGACAATGACAGCATCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092344 Nonsense 719 942 8 13
Genomic Location:
Chromosome 23 (position 4717144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCAGACTGTTTGAGGTCCCAGATCCAAACAGGCTGCAAAAACTCGGG[C/T]AGCACCAGCGGGAAATCTTCCTGTTTAATGATCTTCTAGTGGTAAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092344 Essential Splice Site 766 942 10 13
Genomic Location:
Chromosome 23 (position 4719892)
KASP Assay ID:
554-7591.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGATACCATTTATTAATGTTTGTTATGATGTTCTCTCTCTTTTTTTCA[G/A]TTTATCCAAATGGCATCCGGCTGACGTCAGCCATTCCAGGTGCAGACTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link