B0JZN1_DANRE

Ensembl ID:
ENSDARG00000073817
Description:
LOC561643 protein [Source:UniProtKB/TrEMBL;Acc:B0JZN1]
Human Orthologue:
PWWP2B
Human Description:
PWWP domain containing 2B [Source:HGNC Symbol;Acc:25150]
Mouse Orthologue:
Pwwp2b
Mouse Description:
PWWP domain containing 2B Gene [Source:MGI Symbol;Acc:MGI:2142008]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11977 Nonsense Available for shipment Available now
sa9575 Nonsense Available for shipment Available now
sa9706 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11977
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089544 Nonsense 396 565 4 4
ENSDART00000089545 None None 231 None 3
ENSDART00000089544 Nonsense 396 565 4 4
ENSDART00000089545 None None 231 None 3
Genomic Location:
Chromosome 13 (position 53160591)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAATTAACTTCCGCAAGAGGAAAGCAGACTCTTCCAGCCTTTCTGTGTG[C/A]AGTAGTGACAGTCTAGACGAGTCCAAATCGTTCAGTTCGGATGGCACGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089544 Nonsense 396 565 4 4
ENSDART00000089545 None None 231 None 3
ENSDART00000089544 Nonsense 396 565 4 4
ENSDART00000089545 None None 231 None 3
Genomic Location:
Chromosome 13 (position 53160591)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAATTAACTTCCGCAAGAGGAAAGCAGACTCTTCCAGCCTTTCTGTGTG[C/A]AGTAGTGACAGTCTAGACGAGTCCAAATCGTTCAGTTCGGATGGCACGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9706
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089544 Nonsense 476 565 4 4
ENSDART00000089545 None None 231 None 3
Genomic Location:
Chromosome 13 (position 53160831)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGTGACSRTCGGGGACGTAGTTTGGGGAAAGATTCAYGGCTTCCCTTG[G/A]TGGCCGGCTCGGATCCTCAGTATTAGCGGGACTCGCAGAGAGGACGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/igpaencx