scly

Ensembl ID:
ENSDARG00000073813
ZFIN IDs:
ZDB-GENE-080204-30, ZDB-GENE-080204-30
Description:
selenocysteine lyase [Source:RefSeq peptide;Acc:NP_001103853]
Human Orthologue:
SCLY
Human Description:
selenocysteine lyase [Source:HGNC Symbol;Acc:18161]
Mouse Orthologue:
Scly
Mouse Description:
selenocysteine lyase Gene [Source:MGI Symbol;Acc:MGI:1355310]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2295 Nonsense F2 line generated During 2017
sa10972 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2295
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113596 Nonsense 41 450 2 12
ENSDART00000114347 Nonsense 41 450 3 13
Genomic Location (Zv9):
Chromosome 6 (position 26984921)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27286132
KASP Assay ID:
554-2667.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATGCAATTAATCGAATAACTGTTTTRCTGCAGAATATATATGGATTA[C/A]AACGCCACCACACCAGCCGATCCAGAGGTGATCAGGGTTGTTACTGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113596 Essential Splice Site 106 450 3 12
ENSDART00000114347 Essential Splice Site 106 450 4 13
Genomic Location (Zv9):
Chromosome 6 (position 26986314)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27287525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCGGTGGAAAAGCAGCAGACATTATTTTTACTTCAGGAGGAACTGAGG[T/G]GAGTCATGAAAATGAGCTTGTTTTTTNTTGTTGTAAAAGATAAAATASAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link