or131-2

Ensembl ID:
ENSDARG00000073812
ZFIN ID:
ZDB-GENE-070806-46
Description:
odorant receptor, family H, subfamily 131, member 2 [Source:RefSeq peptide;Acc:NP_001034727]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22616 Nonsense Mutation detected in F1 DNA During 2014
sa14799 Nonsense Available for shipment Available now
sa22615 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109999 Nonsense 26 325 1 1
Genomic Location:
Chromosome 15 (position 17183651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCAACACTTTTATTTCGAAAACACTAAAAGAGAAGTCTTTGACGGTG[C/T]AGGTGCTGGTTGGGATTCTTCTGTATGTGAACGGACTGATGATTTTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14799
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109999 Nonsense 34 325 1 1
Genomic Location:
Chromosome 15 (position 17183625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAAAGAGAAGTCTTTGACGGTGCAGGTGCTGGTTGGGATTCTTCTGTA[T/A]GTGAAYGGACTGATGATTTTCACCTWTCTGAAGAAGGAGACTTTCAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109999 Nonsense 102 325 1 1
Genomic Location:
Chromosome 15 (position 17183421)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATTTCTTGTTATATCTTTTGTACAGTCATGGCTCTGCTCAGTATTTG[T/A]TCTCCGGTGACTCTTGTAGCCATGTGTTTGGAGCGATATGTGGCCATATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r06bw6u9