thbs2b

Ensembl ID:
ENSDARG00000073810
ZFIN ID:
ZDB-GENE-100623-1
Human Orthologue:
THBS2
Human Description:
thrombospondin 2 [Source:HGNC Symbol;Acc:11786]
Mouse Orthologue:
Thbs2
Mouse Description:
thrombospondin 2 Gene [Source:MGI Symbol;Acc:MGI:98738]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35323 Nonsense Mutation detected in F1 DNA During 2016
sa6262 Nonsense Mutation detected in F1 DNA During 2016
sa35324 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111772 Nonsense 185 1181 2 20
Genomic Location (Zv9):
Chromosome 12 (position 32319495)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30540472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATTGGTTGTGGACTCATTGATAGCTTCATTCTTGATGAACCTTTCTA[T/A]GAACACCTTAGTGCAACTGGCGCCAGTATGTTCGTGGCCAAAGGGTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111772 Nonsense 685 1181 11 20
Genomic Location (Zv9):
Chromosome 12 (position 32334346)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30555323
KASP Assay ID:
554-5440.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAAGTTTGCTGAATGCATCTTCCTCAGTCACTTCACTGACCCCATGTA[C/A]AAGTGTGAGTGCCGGATTGGTTATGCTGGAGACGGCATCATCTGTGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111772 Nonsense 885 1181 15 20
Genomic Location (Zv9):
Chromosome 12 (position 32339503)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30560480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAATCAGGACATAGATGAAGATGGACATCAAAATAACATGGATAACTG[C/A]CCATACATACCCAACGCTAACCAAGCTGACCACGACGGAGATGGGAAAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link