si:ch73-266o15.4

Ensembl ID:
ENSDARG00000073808
ZFIN ID:
ZDB-GENE-070705-229
Description:
WD repeat-containing protein 31 [Source:RefSeq peptide;Acc:NP_001093507]
Human Orthologue:
WDR31
Human Description:
WD repeat domain 31 [Source:HGNC Symbol;Acc:21421]
Mouse Orthologue:
Wdr31
Mouse Description:
WD repeat domain 31 Gene [Source:MGI Symbol;Acc:MGI:1918604]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20348 Nonsense Available for shipment Available now
sa33536 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113448 Nonsense 98 342 4 9
ENSDART00000141831 Nonsense 98 342 5 10
Genomic Location (Zv9):
Chromosome 5 (position 10905761)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 9493521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCCAGTTGTGTTGTTTTAAAGGGAGTTCCCTGATCTTCAGCGCATCT[C/T]GAGATAAGACGGTGCTGATGTGGGATTTGGGACGAGATACAGAAGCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113448 Nonsense 109 342 4 9
ENSDART00000141831 Nonsense 109 342 5 10
Genomic Location (Zv9):
Chromosome 5 (position 10905728)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 9493488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCTTCAGCGCATCTCGAGATAAGACGGTGCTGATGTGGGATTTGGGA[C/T]GAGATACAGAAGCCATCCAGGAGTTCAGTGGTCATGAGCTTGTCGTTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link