si:ch211-229p19.3

Ensembl ID:
ENSDARG00000073805
ZFIN ID:
ZDB-GENE-090311-8
Human Orthologue:
OGDH
Human Description:
oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) [Source:HGNC Symbol;Acc:8124]
Mouse Orthologue:
Ogdh
Mouse Description:
oxoglutarate dehydrogenase (lipoamide) Gene [Source:MGI Symbol;Acc:MGI:1098267]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11227 Nonsense Available for shipment Available now
sa34993 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013485 Nonsense 534 1023 11 22
ENSDART00000139214 Nonsense 534 1023 12 23

The following transcripts of ENSDARG00000073805 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 46172846)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45338230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAYGAGCCCATGTTTACTCAACCGCTGATGTACAAACAGATCAAGAAG[C/T]AGAAACCTGTTCWGCAGAAATATGYGGAGAAGCTGATCGCAGAAGGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013485 Nonsense 648 1023 14 22
ENSDART00000139214 Nonsense 648 1023 15 23

The following transcripts of ENSDARG00000073805 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 46170249)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45340827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGTTTGCAGGTCTGAGCCGTATCTTGAAGAGCCGGTCGCTGATGGTG[C/T]AGAACCGCTCTGTGGACTGGGCTCTGGGCGAATATATGGCGTTCGGTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link