HOMER1 (1 of 3)

Ensembl ID:
ENSDARG00000073803
Description:
homer homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:17512]
Human Orthologue:
HOMER1
Human Description:
homer homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:17512]
Mouse Orthologue:
Homer1
Mouse Description:
homer homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1347345]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32321 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112566 Nonsense 44 132 1 3
Genomic Location (Zv9):
Chromosome 21 (position 174591)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACCAGAGCTCATGTCTTCCAGATCGACCCGAACACAAAGAAGAACTG[G/A]GTTCCCACCAGCAAGCACGCCGTCACTGTGTCCTACTTCTACGACAGCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Common variants in the GDF5-UQCC region are associated with variation in human height. (View Study)
  • Major depressive disorder: Genome-wide association-, replication-, and neuroimaging study implicates HOMER1 in the etiology of major depression. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link