cntnap5

Ensembl ID:
ENSDARG00000073802
Human Orthologue:
CNTNAP5
Human Description:
contactin associated protein-like 5 [Source:HGNC Symbol;Acc:18748]
Mouse Orthologues:
Cntnap5a, Cntnap5b, Cntnap5c
Mouse Descriptions:
contactin associated protein-like 5A Gene [Source:MGI Symbol;Acc:MGI:3643623]
contactin associated protein-like 5B Gene [Source:MGI Symbol;Acc:MGI:3664583]
contactin associated protein-like 5C Gene [Source:MGI Symbol;Acc:MGI:3646013]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13748 Nonsense Available for shipment Available now
sa21940 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8838 Nonsense Mutation detected in F1 DNA During 2014
sa21941 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13789 Essential Splice Site Available for shipment Available now
sa14172 Essential Splice Site Available for shipment Available now
sa9104 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111193 Nonsense 80 1310 3 24
Genomic Location:
Chromosome 11 (position 34313838)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGAGGTGGGGGGTGGTCTCCRAGCGGAGAAGACCAGCAMCCTTGGCTT[C/T]AGCTGGACCTACGGGAYAGGTTGAAGGTCACATCCATTGCCACCCAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111193 Essential Splice Site 246 1310 6 24
Genomic Location:
Chromosome 11 (position 34347148)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTTTGCTTATGTTGTCCAGTCTATGTTTCTAGTGTCTTTCTCTGTAC[A/T]GATGATGCCAAGCCCCAGTCTGGTGGTCGCTCATCATCTGTCATGTTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111193 Nonsense 348 1310 7 24
Genomic Location:
Chromosome 11 (position 34351027)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAGAAYCTCAACTACAACGGCGTCAATGTCATCGACATGGCAAAGMGA[C/T]GAAAGCCACAGATTTATACCGTGGTAAGTTTGAANNNGAACAATCGCAWT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111193 Essential Splice Site 495 1310 9 24
Genomic Location:
Chromosome 11 (position 34357764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCACTGGACGTAGCCAAACCCCCCAGAGAACAACCATCTACATTGGAG[G/A]TACAGCATTAGAAATGCAAAAAGTCAGTTTATTCTTACTAGCTGTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13789
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111193 Essential Splice Site 553 1310 10 24
Genomic Location:
Chromosome 11 (position 34358554)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGGCAACTTTAGCCAGATTAGCTTTGATGTTTGCAACATACAAGWTAG[G/A]TCTGTTTCMCTGTGTGTGCNNGTGTGTGTGTCTGTGTTTATGTGAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111193 Essential Splice Site 921 1310 18 24
Genomic Location:
Chromosome 11 (position 34373505)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGGCTTTGTAAATTGCCRAGACAAYTAATCATTGTAATCTCCCCATTA[G/T]GAGGAACGGCTTCAAGGCAGAGGGGCTTCGTGGGCTGCTTACGCGCKCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111193 Nonsense 1025 1310 19 24
Genomic Location:
Chromosome 11 (position 34375845)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCTTCAGTCCTGTATACTCTCCAKGAGCCATTTTCTGGGATACTAAAC[G/T]AGGAAGCCAGAAGWWCGCCGGCTGGTTTCCATGATGCAGAAGTTGCCAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cttpprdg