im:6893790

Ensembl ID:
ENSDARG00000073797
ZFIN ID:
ZDB-GENE-080225-1
Human Orthologues:
AC092375.1, RRN3, RRN3P2, RRN3P3
Human Descriptions:
Putative RRN3-like protein FLJ77916 [Source:UniProtKB/Swiss-Prot;Acc:Q2M238]
RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2 [Source:HGNC Symbol;Acc:3
RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 3 [Source:HGNC Symbol;Acc:3
RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:30346]
Mouse Orthologue:
Rrn3
Mouse Description:
RRN3 RNA polymerase I transcription factor homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1925255]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40116 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114265 Nonsense 257 633 10 18
Genomic Location (Zv9):
Chromosome 3 (position 36592431)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36456673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATGTTTAGGTTAGCGCACCGCGAAGTGAGATTGAAGAAGTGGAAAGT[G/T]GAGCTCAGCAAGGCGCCAGTGGAGCATCACAGGATGACTGCCTCTTCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link