si:ch211-181b18.1

Ensembl ID:
ENSDARG00000073792
ZFIN ID:
ZDB-GENE-091116-34
Human Orthologue:
MAN1B1
Human Description:
mannosidase, alpha, class 1B, member 1 [Source:HGNC Symbol;Acc:6823]
Mouse Orthologue:
Man1b1
Mouse Description:
mannosidase, alpha, class 1B, member 1 Gene [Source:MGI Symbol;Acc:MGI:2684954]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43604 Nonsense Mutation detected in F1 DNA During 2017
sa37256 Nonsense Mutation detected in F1 DNA During 2017
sa31055 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114715 Nonsense 138 682 4 14
Genomic Location (Zv9):
Chromosome 21 (position 12442016)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14143190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAGATGTTATGCCAGAGCTTCAGAAACCCAGCATTCCATTACTTCCT[A/T]AACCTCCAGCTATGGTTAGTGGAAATGCATAATTCACTGTTATACAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114715 Nonsense 227 682 7 14
Genomic Location (Zv9):
Chromosome 21 (position 12434755)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14135929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTAAAGCTCTAATCTTAAAGTGTTTTATTTGTGATGCTCAGGGACAT[T/A]GAAGCCAGTGGATCGTGTGGAAGCGGTGCAGGAGGCCTTCAGGCATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114715 Nonsense 449 682 10 14
Genomic Location (Zv9):
Chromosome 21 (position 12428653)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14129827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACGCGGCGAGGGGCCTTTACCCTGGGGGCCCGAGCAGACAGTTACTA[C/A]GAGTACCTGCTCAAACAGTGGCTTCAGGGCGGCAAGAAGGAGACTGAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link