LOC793917

Ensembl ID:
ENSDARG00000073789
Human Orthologues:
SAMD9, SAMD9L
Human Descriptions:
sterile alpha motif domain containing 9 [Source:HGNC Symbol;Acc:1348]
sterile alpha motif domain containing 9-like [Source:HGNC Symbol;Acc:1349]
Mouse Orthologue:
Samd9l
Mouse Description:
sterile alpha motif domain containing 9-like Gene [Source:MGI Symbol;Acc:MGI:1343184]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12462 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111561 Nonsense 197 1178 1 1
Genomic Location:
Chromosome 22 (position 33719035)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAGGACATGAAGACATTATATGCCTAGCTGAATCWGAGGAGAATTTC[A/T]AGAAATGGCAGRGCTTTGCTCTAGGATCTWGTGACATGGAAACAATAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jglnlscp