LOC100334565

Ensembl ID:
ENSDARG00000073784
Human Orthologue:
FEZ2
Human Description:
fasciculation and elongation protein zeta 2 (zygin II) [Source:HGNC Symbol;Acc:3660]
Mouse Orthologue:
Fez2
Mouse Description:
fasciculation and elongation protein zeta 2 (zygin II) Gene [Source:MGI Symbol;Acc:MGI:2675856]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36016 Nonsense Mutation detected in F1 DNA During 2017
sa39075 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092299 Nonsense 131 376 2 9
Genomic Location (Zv9):
Chromosome 16 (position 3426518)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2584894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGTCTCGAGTGCGGTCTCTTCACCTGTCAACACTGAGTCTGGATGAC[C/T]GAGCGGTGAGTTTTCAACTTGTCAGTGCTAGGCATAAGATGCGGTTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092299 Nonsense 276 376 5 9
Genomic Location (Zv9):
Chromosome 16 (position 3429892)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2588268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCTTCATCTCGGTGCTCATCGACGTACAGAACCGGCAGAAGCTGCAG[C/T]GAGAGATGCTGAAGAAGAAGAGGAAAGTGAGGAGCACGTCAGGATCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link