
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LOC100007225
- Ensembl ID:
- ENSDARG00000073780
- Mouse Orthologues:
- AC139131.1, AC161211.1, AC161211.2, Vmn2r54
- Mouse Descriptions:
- vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
- vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
- vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
- vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7106 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa7106
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056223 | Essential Splice Site | 538 | 839 | 5 | 7 |
- Genomic Location (Zv9):
- Chromosome 7 (position 72034931)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 32647134 GRCz11 18 32617590 - KASP Assay ID:
- 554-4570.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTTATGACTGTATCCCATGTGCAGAAGGAGAAATAAGTAATCAGACAGG[T/C]AATCTTCAGCATATCTCACAGATTCAAAGAAAATTGTTATTTTTAGTTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: