ENSDARG00000073777

Ensembl ID:
ENSDARG00000073777
Human Orthologue:
ANKFN1
Human Description:
ankyrin-repeat and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:26766]
Mouse Orthologue:
Ankfn1
Mouse Description:
ankyrin-repeat and fibronectin type III domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2686021]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17641 Nonsense Available for shipment Available now
sa13151 Essential Splice Site Available for shipment Available now
sa44188 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17641
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111366 Nonsense 281 413 6 9
Genomic Location (Zv9):
Chromosome 24 (position 40512378)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38996042
KASP Assay ID:
2261-9057.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGTCTCTTGTTTCAGGGCACAGGCTGTTATGTCCAGGTCTCAGCATA[T/G]AATATGAAGGGATGGAGTTCACCTCAGATATCAGAACCTGCTTGTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111366 Essential Splice Site 301 413 6 9
Genomic Location (Zv9):
Chromosome 24 (position 40512438)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38995982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGGAGTTCACCTCAGATATCAGAACCTGCTTGTGCTACACCCTCCAG[T/C]GAGTTACACRCACACATAAACACATRTTGGTTWTGGTGGTTTATGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111366 Splice Site, Nonsense 338 413 8 9
Genomic Location (Zv9):
Chromosome 24 (position 40516889)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38991531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGACTCTTCTGTTTCTCTTGTGTTTCCATCCTCTCTGTGTTTAGAA[C/T]AAATCAAAGCTCCGTCGAACACCAGAAAACATTCTGTCTCTAAAAGTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link