LOC100332088

Ensembl ID:
ENSDARG00000073771
Human Orthologue:
TBC1D12
Human Description:
TBC1 domain family, member 12 [Source:HGNC Symbol;Acc:29082]
Mouse Orthologue:
Tbc1d12
Mouse Description:
TBC1D12: TBC1 domain family, member 12 Gene [Source:MGI Symbol;Acc:MGI:2384803]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41958 Nonsense Mutation detected in F1 DNA During 2017
sa41959 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109305 Nonsense 88 771 2 15
Genomic Location (Zv9):
Chromosome 12 (position 6333902)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5417423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGAAAAGGGCCAATTACAGAGCAGCCAGGAGCATGAGGCGACGGAGT[C/A]ATGTGATGAAGTAAACCTGCCATGTGGCGCTAAGCTCCCGAATGGACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109305 Nonsense 445 771 7 15
Genomic Location (Zv9):
Chromosome 12 (position 6348018)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5403307
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGCTAAAAGAGGCTCAGAAGAAGAAAAAGCAGATGAAAGAAAGGTTT[A/T]AACAGGAAGAGAGCATCGCTAACGCCATGGTGGTTTGGAACACTGAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link