LOC100005879

Ensembl ID:
ENSDARG00000073768
Human Orthologue:
TMEM125
Human Description:
transmembrane protein 125 [Source:HGNC Symbol;Acc:28275]
Mouse Orthologue:
Tmem125
Mouse Description:
transmembrane protein 125 Gene [Source:MGI Symbol;Acc:MGI:1923409]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38558 Nonsense Mutation detected in F1 DNA During 2017
sa31519 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111020 Nonsense 3 222 1 1
Genomic Location (Zv9):
Chromosome 6 (position 33781420)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34098985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAACTGGGAGCCCATCTTCATTACCCCACCAGCCGAACATTATGTCA[G/T]AGATGGAGGATTACTCTCCTCCGAGAGGCCACCCTCATCCTGACCCGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111020 Nonsense 118 222 1 1
Genomic Location (Zv9):
Chromosome 6 (position 33781074)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34098639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACTGCGTGAGAAGCAGACGACGGATCAACATGCTAAAGAGCGGAGGTT[T/A]GTCGGACATCCTCATTATGTTGATCACAGGAGCCTCTCTGCTTATTTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link