LOC558239

Ensembl ID:
ENSDARG00000073764
Human Orthologue:
CYP27A1
Human Description:
cytochrome P450, family 27, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2605]
Mouse Orthologue:
Cyp27a1
Mouse Description:
cytochrome P450, family 27, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88594]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14141 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109113 Nonsense 540 573 9 9
Genomic Location:
Chromosome 6 (position 8255214)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCTGACTGTTGTTNTCACTTTCTTTCAYCACCAGCTGATGCAAMAATA[T/G]GAGGTCAGAACRAAGGCCGGATCTCCATCCATCCAGCCCAAAACCAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xpfmkub4