LOC563949

Ensembl ID:
ENSDARG00000073747
Human Orthologues:
CPN2, GP1BA, GP5, LRG1, LRRC15, NYX
Human Descriptions:
carboxypeptidase N, polypeptide 2 [Source:HGNC Symbol;Acc:2313]
glycoprotein Ib (platelet), alpha polypeptide [Source:HGNC Symbol;Acc:4439]
glycoprotein V (platelet) [Source:HGNC Symbol;Acc:4443]
leucine rich repeat containing 15 [Source:HGNC Symbol;Acc:20818]
leucine-rich alpha-2-glycoprotein 1 [Source:HGNC Symbol;Acc:29480]
nyctalopin [Source:HGNC Symbol;Acc:8082]
Mouse Orthologues:
1200009O22Rik, Cpn2, Gp1ba, Gp5, Lrg1, Lrrc15, Nyx
Mouse Descriptions:
carboxypeptidase N, polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:1919006]
glycoprotein 1b, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:1333744]
glycoprotein 5 (platelet) Gene [Source:MGI Symbol;Acc:MGI:1096363]
leucine rich repeat containing 15 Gene [Source:MGI Symbol;Acc:MGI:1921738]
leucine-rich alpha-2-glycoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:1924155]
nyctalopin Gene [Source:MGI Symbol;Acc:MGI:2448607]
RIKEN cDNA 1200009O22 gene Gene [Source:MGI Symbol;Acc:MGI:1914123]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4109 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111127 Nonsense 233 300 2 3
Genomic Location:
Chromosome 20 (position 36407520)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGTTTGGACCCCTGACTGGTCTTGAGATGCTGGTGCTAGACAACAATT[T/A]GCTCTCCACACTAACTGTGTCYACTCTGGAGGGTCTTTCAAACCTGCAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ckjdjygk