si:ch211-120k19.2

Ensembl ID:
ENSDARG00000073732
ZFIN ID:
ZDB-GENE-100921-1
Human Orthologue:
MYH14
Human Description:
myosin, heavy chain 14, non-muscle [Source:HGNC Symbol;Acc:23212]
Mouse Orthologue:
Myh14
Mouse Description:
myosin, heavy polypeptide 14 Gene [Source:MGI Symbol;Acc:MGI:1919210]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15579 Essential Splice Site Available for shipment Available now
sa17178 Nonsense Available for shipment Available now
sa16888 Nonsense Available for shipment Available now
sa36084 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36085 Nonsense Mutation detected in F1 DNA During 2017
sa44846 Nonsense Mutation detected in F1 DNA During 2017
sa22798 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047409 Essential Splice Site 175 2020 4 42
ENSDART00000142155 Essential Splice Site 175 2007 5 41
Genomic Location (Zv9):
Chromosome 16 (position 18938522)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16968845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTTCATGTNATKCTAATGTCCTTCCTCTTTCTGTTTTTTTTTTYACTC[A/T]GACCGAGAAGATCAGTCTATCCTCTGCACGTGAGTTTCCACTGCCTRYGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047409 Nonsense 236 2020 7 42
ENSDART00000142155 Nonsense 232 2007 7 41
Genomic Location (Zv9):
Chromosome 16 (position 18945051)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16975374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RGCTATTCTTCTTTTGTTGTGCYTAGGGGGAGCTGGAAAKACAGTTACTG[C/T]AAGCAAACCCCAKTCTTGAGGCCTTCGGMAAYGCCAAGACTGTCAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047409 Nonsense 831 2020 20 42
ENSDART00000142155 Nonsense 827 2007 20 41
Genomic Location (Zv9):
Chromosome 16 (position 18968434)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16998757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGMACCGTATTTTAACGAYTATGTTTTTCAGGGCATTCCATAAGAAGCAG[C/T]AGCAGCTTAGTGCTCTGCGGGTGATGCAGAGAAATTGTGCTGCRTATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047409 Essential Splice Site 973 2020 22 42
ENSDART00000142155 Essential Splice Site 969 2007 22 41
Genomic Location (Zv9):
Chromosome 16 (position 18970338)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17000661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTGTTCAGCTGACCAATGAGAAGAAGAGGATCCAGCAACATGTGCAG[G/A]TTTGCAGGATGGTTCTGTTGCTGTCTAACTACAGATGTTCGATTTCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047409 Nonsense 1079 2020 25 42
ENSDART00000142155 Nonsense 1075 2007 25 41
Genomic Location (Zv9):
Chromosome 16 (position 18975842)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17006165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGAAAAGGGAAGAGCAGGGTCGTCTGGAACAGGAGAAGTGGAAGCGG[C/T]GAATGGAAGGAGAAGCAGTGGAGGCTCAAGAGCAGCTATCTGACATGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047409 Nonsense 1673 2020 35 42
ENSDART00000142155 Nonsense 1669 2007 35 41
Genomic Location (Zv9):
Chromosome 16 (position 18990070)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCCCTGATGTGAACATTTTGATGTGTTCCTGTGTGTTTTTTAAGACT[C/T]AGATGAAGGAGCTTATTCGTGAGCTTGACGAAACCAAGTTGGCTCGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047409 Essential Splice Site 1949 2020 40 42
ENSDART00000142155 Essential Splice Site 1945 2007 40 41

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 18996330)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17026653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATGCAGAGCATGAACCGCGAGCTCAACACTCTCCGCTCCCAACTCAG[G/A]TAAGGACAATGACAGTTATGACTGTGTGTTCGCCGTTTTGTGTATGGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link