LOC100330824

Ensembl ID:
ENSDARG00000073728
Human Orthologue:
GAL3ST3
Human Description:
galactose-3-O-sulfotransferase 3 [Source:HGNC Symbol;Acc:24144]
Mouse Orthologue:
Gal3st3
Mouse Description:
galactose-3-O-sulfotransferase 3 Gene [Source:MGI Symbol;Acc:MGI:3617843]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13055 Essential Splice Site Available for shipment Available now
sa25352 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13055
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109485 Essential Splice Site 28 429 1 2
Genomic Location:
Chromosome 7 (position 8066822)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCARTCAGCACTGTCAGCTTTCTTCTRCACCATGGGGGTCACTTGAACTT[G/T]TAAGAGCCTTTGAAAAATKATCCTTTCATTCAGTCCACACCCTCAWACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109485 Nonsense 396 429 2 2
Genomic Location:
Chromosome 7 (position 8069987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGCCAGAAGTGCAATACACAAAGCTGTTGCTTCGTTCAGAATCTGTA[C/T]GATATCGAAAGCGGCTTCCAATACGGAGCCGCCAGCAGACTGCACGGTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fr11079f