nlrx1

Ensembl ID:
ENSDARG00000073724
ZFIN ID:
ZDB-GENE-071119-3
Human Orthologue:
NLRX1
Human Description:
NLR family member X1 [Source:HGNC Symbol;Acc:29890]
Mouse Orthologue:
Nlrx1
Mouse Description:
NLR family member X1 Gene [Source:MGI Symbol;Acc:MGI:2429611]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6376 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35882 Nonsense Mutation detected in F1 DNA During 2017
sa15956 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114416 Essential Splice Site 59 1005 2 8
Genomic Location (Zv9):
Chromosome 15 (position 22833822)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23545009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTGGCATCTGCAGAAATATAAAGCGATGTCACTTGTCATTCCCAATG[T/A]AAGTATTATAAGAAATAAACTTTTTMTAAWGTTTTTATTTCAAAYAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114416 Nonsense 771 1005 5 8
Genomic Location (Zv9):
Chromosome 15 (position 22828206)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23539393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCTGCCACATCACGCCAGAACTGCTGCAGATGCTTTGGCCAGCCTTC[C/T]GACACACCAGAAACCTCAAGTGAGACATCCACTTACTAATATGGATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114416 Nonsense 908 1005 8 8
Genomic Location (Zv9):
Chromosome 15 (position 22822664)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23533851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACCTGAATCAGCTYACCGACGTGGCCAAGCAGTCTTTATATGTGCGT[G/T]GAGGTCCTCGGGTRAAGGAGGGCCGGCGGGTKAAAGTCCTGGCTTCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link