APOL2

Ensembl ID:
ENSDARG00000073718
Description:
apolipoprotein L, 2 [Source:HGNC Symbol;Acc:619]
Human Orthologues:
APOL1, APOL2, APOL3, APOL5, APOL6
Human Descriptions:
apolipoprotein L, 1 [Source:HGNC Symbol;Acc:618]
apolipoprotein L, 2 [Source:HGNC Symbol;Acc:619]
apolipoprotein L, 3 [Source:HGNC Symbol;Acc:14868]
apolipoprotein L, 5 [Source:HGNC Symbol;Acc:14869]
apolipoprotein L, 6 [Source:HGNC Symbol;Acc:14870]
Mouse Orthologues:
AL591864.1, AL592187.1, AL592187.2, Apol10a, Apol10b, Apol6, Apol7a, Apol7b, Apol7c, Apol7e, Apol8, Apol9a, Apol9b
Mouse Descriptions:
apolipoprotein L 10a Gene [Source:MGI Symbol;Acc:MGI:3036238]
apolipoprotein L 10b Gene [Source:MGI Symbol;Acc:MGI:3043522]
apolipoprotein L 11a [Source:RefSeq peptide;Acc:NP_001171004]
apolipoprotein L 11b [Source:RefSeq peptide;Acc:NP_001137158]
apolipoprotein L 6 Gene [Source:MGI Symbol;Acc:MGI:1919189]
apolipoprotein L 7a Gene [Source:MGI Symbol;Acc:MGI:1923011]
apolipoprotein L 7b Gene [Source:MGI Symbol;Acc:MGI:3583950]
apolipoprotein L 7c Gene [Source:MGI Symbol;Acc:MGI:1920912]
apolipoprotein L 7e Gene [Source:MGI Symbol;Acc:MGI:3704456]
apolipoprotein L 8 Gene [Source:MGI Symbol;Acc:MGI:2444921]
apolipoprotein L 9a Gene [Source:MGI Symbol;Acc:MGI:3606001]
apolipoprotein L 9b Gene [Source:MGI Symbol;Acc:MGI:1919148]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17264 Nonsense Available for shipment Available now
sa6898 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2137 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112891 None None 275 None 3
ENSDART00000130102 Nonsense 4 557 1 4
Genomic Location:
Chromosome 3 (position 29830579)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTGATTCTTGAMACAGAGAAGAACTACAGCATCTCCTCTCMGAGTA[T/A]GTCGAAAACACTCTAAACTACATCCAGACAGTGAGAGACTTCTGCGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112891 None None 275 None 3
ENSDART00000130102 Essential Splice Site 190 557 1 4
Genomic Location:
Chromosome 3 (position 29830020)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAATACATACGAATCACWGAACAGATTTGTGAGAGGATTGAGAAAAAG[T/C]TAGTACTTGAATTCATTTGTTKTACTTATTTGATTGACACAGGGTAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112891 Nonsense 18 275 1 3
ENSDART00000130102 Nonsense 242 557 3 4
Genomic Location:
Chromosome 3 (position 29826785)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGTGAGGACTCCATGCAAAACATGCKCGMTCATTTGAAGCAGTTGTGC[A/T]AAATAAGGTGAGACCTCTAGCTTTTTTNATTTGATCAGCTGCTTCTTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Glomerulosclerosis: A risk allele for focal segmental glomerulosclerosis in African Americans is located within a region containing APOL1 and MYH9. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/buvrlkl3