si:dkey-19p15.7

Ensembl ID:
ENSDARG00000073716
ZFIN ID:
ZDB-GENE-030131-5284
Description:
Novel protein similar to vertebrate AE binding protein 1 (AEBP1, wu:fa25h05) [Source:UniProtKB/TrEMB
Human Orthologue:
CPXM1
Human Description:
carboxypeptidase X (M14 family), member 1 [Source:HGNC Symbol;Acc:15771]
Mouse Orthologue:
Cpxm1
Mouse Description:
carboxypeptidase X 1 (M14 family) Gene [Source:MGI Symbol;Acc:MGI:1934569]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15688 Nonsense Available for shipment Available now
sa22231 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058066 Nonsense 328 723 8 13
ENSDART00000111393 Nonsense 324 719 8 13
Genomic Location (Zv9):
Chromosome 13 (position 8958198)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9260818
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTTTTNGTKTAGGTGAGCCAGAATTTCGCTATGTTGCCGGGATGCAT[G/T]GAAATGAAGTTTTGGGACGCGAGCTCCTGCTAAACCTTATGCAGTACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058066 Nonsense 715 723 13 13
ENSDART00000111393 Nonsense 711 719 13 13
Genomic Location (Zv9):
Chromosome 13 (position 8941096)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9243716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAACTCCGAGCCAGCACCAAGATCCTGAACCGCCGGCGAGAACAGCAG[C/T]AGCGTCTTAACAAAGTTAACCGCAAGTGATTTATGAAACTGAGTCGGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link